Transcript: Mouse XM_017314786.1

PREDICTED: Mus musculus solute carrier family 38, member 10 (Slc38a10), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc38a10 (72055)
Length:
4448
CDS:
750..3410

Additional Resources:

NCBI RefSeq record:
XM_017314786.1
NBCI Gene record:
Slc38a10 (72055)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313082 GATTGGAGGCCACGTTCTTAT pLKO_005 3477 3UTR 100% 13.200 18.480 N Slc38a10 n/a
2 TRCN0000102187 CCTCCCTAATGTTCAGGTGAA pLKO.1 3278 CDS 100% 4.050 5.670 N Slc38a10 n/a
3 TRCN0000102186 CCGGCTCTGATCTATAAGAAA pLKO.1 1158 CDS 100% 5.625 3.938 N Slc38a10 n/a
4 TRCN0000312094 CCGGCTCTGATCTATAAGAAA pLKO_005 1158 CDS 100% 5.625 3.938 N Slc38a10 n/a
5 TRCN0000102185 GCAGAGAACAAGGTTATGTTT pLKO.1 4249 3UTR 100% 5.625 3.938 N Slc38a10 n/a
6 TRCN0000102189 CCAAGGTATTGCTGTCCCTAT pLKO.1 1526 CDS 100% 4.050 2.835 N Slc38a10 n/a
7 TRCN0000312095 CCAAGGTATTGCTGTCCCTAT pLKO_005 1526 CDS 100% 4.050 2.835 N Slc38a10 n/a
8 TRCN0000313081 TGGTACACAGCCGACAGATTA pLKO_005 3358 CDS 100% 13.200 7.920 N Slc38a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314786.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.