Transcript: Mouse XM_017314801.1

PREDICTED: Mus musculus arylsulfatase G (Arsg), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arsg (74008)
Length:
3124
CDS:
738..2315

Additional Resources:

NCBI RefSeq record:
XM_017314801.1
NBCI Gene record:
Arsg (74008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358699 CTACTTTGGAATCCCATATAG pLKO_005 1202 CDS 100% 13.200 18.480 N ARSG n/a
2 TRCN0000101636 CGTGGCTTCGATTACTACTTT pLKO.1 1188 CDS 100% 5.625 7.875 N Arsg n/a
3 TRCN0000101635 GCAATGCCTTAAACCTCAATT pLKO.1 2582 3UTR 100% 13.200 10.560 N Arsg n/a
4 TRCN0000101637 CCTATCAAACTACCTGCCGTT pLKO.1 2281 CDS 100% 2.160 1.728 N Arsg n/a
5 TRCN0000051346 CCTCTGGTTTACAGGAGACAA pLKO.1 1625 CDS 100% 4.950 3.465 N ARSG n/a
6 TRCN0000101639 GATTTCTCTATCAGTGGGAAA pLKO.1 807 CDS 100% 4.050 2.835 N Arsg n/a
7 TRCN0000101638 CGGAAATTTGATGGACGGGAT pLKO.1 1887 CDS 100% 2.160 1.512 N Arsg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.