Transcript: Mouse XM_017314852.1

PREDICTED: Mus musculus cadherin 22 (Cdh22), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh22 (104010)
Length:
3560
CDS:
348..2903

Additional Resources:

NCBI RefSeq record:
XM_017314852.1
NBCI Gene record:
Cdh22 (104010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438970 ATTGATCGGGACTCGGATTTG pLKO_005 1746 CDS 100% 10.800 15.120 N Cdh22 n/a
2 TRCN0000094335 CGCTACGAGGTGGTTATTCAA pLKO.1 1170 CDS 100% 5.625 7.875 N Cdh22 n/a
3 TRCN0000428639 GCTTTCTGGCATCCAATTAAA pLKO_005 3161 3UTR 100% 15.000 10.500 N Cdh22 n/a
4 TRCN0000419642 GATGCAGACGACCCTACTTAC pLKO_005 1032 CDS 100% 10.800 7.560 N Cdh22 n/a
5 TRCN0000094337 CGAGTCGGAGTTCATCATCAA pLKO.1 902 CDS 100% 4.950 3.465 N Cdh22 n/a
6 TRCN0000094336 GATGAAGACATGCGGGACAAT pLKO.1 2430 CDS 100% 4.950 3.465 N Cdh22 n/a
7 TRCN0000437174 GAAGGAAGGGCTGGTCATTTA pLKO_005 3185 3UTR 100% 13.200 7.920 N Cdh22 n/a
8 TRCN0000094338 GTTCTCATCCTGGTTGTTCTT pLKO.1 2352 CDS 100% 4.950 2.970 N Cdh22 n/a
9 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 3411 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.