Transcript: Mouse XM_017314865.1

PREDICTED: Mus musculus zinc finger protein 717-like (LOC108167848), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC108167848 (108167848)
Length:
4140
CDS:
184..2067

Additional Resources:

NCBI RefSeq record:
XM_017314865.1
NBCI Gene record:
LOC108167848 (108167848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238594 CGCAGATGCAGTCTGGTAATT pLKO_005 472 CDS 100% 13.200 18.480 N Gm12258 n/a
2 TRCN0000238592 CCCATCTCACACAGCATTTAA pLKO_005 962 CDS 100% 15.000 10.500 N Gm12258 n/a
3 TRCN0000238595 ATGAGCCCTGGGCCACTTAAT pLKO_005 595 CDS 100% 13.200 9.240 N Gm12258 n/a
4 TRCN0000238593 CAAAGTGTGTGGGAAGTTATT pLKO_005 930 CDS 100% 13.200 9.240 N Gm12258 n/a
5 TRCN0000238596 TTGTGAGCCAATACTCAATAT pLKO_005 1020 CDS 100% 13.200 9.240 N Gm12258 n/a
6 TRCN0000242402 GAGAAACCCTATGACTGTAAA pLKO_005 2675 3UTR 100% 13.200 6.600 Y Gm14434 n/a
7 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1714 CDS 100% 13.200 6.600 Y LOC676710 n/a
8 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1714 CDS 100% 10.800 5.400 Y Zfp647 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.