Transcript: Mouse XM_017314926.1

PREDICTED: Mus musculus phospholipase D family, member 4 (Pld4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pld4 (104759)
Length:
914
CDS:
100..879

Additional Resources:

NCBI RefSeq record:
XM_017314926.1
NBCI Gene record:
Pld4 (104759)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248026 TACGACAAGTGCCCATGAAAC pLKO_005 692 CDS 100% 10.800 8.640 N Pld4 n/a
2 TRCN0000248029 GGGTGTTCTACACTCCAAATT pLKO_005 723 CDS 100% 13.200 9.240 N Pld4 n/a
3 TRCN0000190733 GCTCATCCTTGTGGAAAGCAT pLKO.1 378 CDS 100% 3.000 2.100 N Pld4 n/a
4 TRCN0000200939 CTACACTCCAAATTCTGGGTT pLKO.1 730 CDS 100% 2.640 1.848 N Pld4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.