Transcript: Mouse XM_017315020.1

PREDICTED: Mus musculus adenylate kinase 1 (Ak1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ak1 (11636)
Length:
3786
CDS:
1781..2437

Additional Resources:

NCBI RefSeq record:
XM_017315020.1
NBCI Gene record:
Ak1 (11636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024952 GCGGCTGGAGACTTATTACAA pLKO.1 2296 CDS 100% 5.625 4.500 N Ak1 n/a
2 TRCN0000274549 GCGGCTGGAGACTTATTACAA pLKO_005 2296 CDS 100% 5.625 4.500 N Ak1 n/a
3 TRCN0000024953 ACTTATTACAATGCCACAGAA pLKO.1 2306 CDS 100% 4.950 3.960 N Ak1 n/a
4 TRCN0000024949 CGAGATGCTATGTTAGCCAAA pLKO.1 2081 CDS 100% 4.050 3.240 N Ak1 n/a
5 TRCN0000274497 ATCTTGACTCCCTGAAGTAAC pLKO_005 2418 CDS 100% 10.800 7.560 N Ak1 n/a
6 TRCN0000285239 TCTATGACAAGCGTGGCATTG pLKO_005 2340 CDS 100% 6.000 4.200 N Ak1 n/a
7 TRCN0000024951 GAGGTGAAACAGGGAGAAGAA pLKO.1 2144 CDS 100% 4.950 3.465 N Ak1 n/a
8 TRCN0000285242 GAGGTGAAACAGGGAGAAGAA pLKO_005 2144 CDS 100% 4.950 3.465 N Ak1 n/a
9 TRCN0000024950 GCTGAAGAAGGCCAAGATCAT pLKO.1 1514 5UTR 100% 4.950 3.465 N Ak1 n/a
10 TRCN0000274496 TCCTGTCCCATGGACACTAAA pLKO_005 2557 3UTR 100% 13.200 7.920 N Ak1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.