Transcript: Mouse XM_017315138.1

PREDICTED: Mus musculus pecanex homolog (Drosophila) (Pcnx), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcnx (54604)
Length:
5862
CDS:
94..3699

Additional Resources:

NCBI RefSeq record:
XM_017315138.1
NBCI Gene record:
Pcnx (54604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217881 GGAATCCGTATGTCCATTAAA pLKO.1 2233 CDS 100% 15.000 21.000 N Pcnx n/a
2 TRCN0000190115 CCGAGTTCTTACCACCTACTA pLKO.1 1752 CDS 100% 4.950 6.930 N Pcnx n/a
3 TRCN0000339560 CCGAGTTCTTACCACCTACTA pLKO_005 1752 CDS 100% 4.950 6.930 N Pcnx n/a
4 TRCN0000200544 CGATGATAAATACGTGACTAT pLKO.1 3639 CDS 100% 4.950 6.930 N Pcnx n/a
5 TRCN0000216831 GAAGCATTTGGTTCGACATAT pLKO.1 4095 3UTR 100% 13.200 9.240 N Pcnx n/a
6 TRCN0000190116 CCAACATTTCCCATGCCAGAA pLKO.1 3371 CDS 100% 4.050 2.835 N Pcnx n/a
7 TRCN0000339489 CCAACATTTCCCATGCCAGAA pLKO_005 3371 CDS 100% 4.050 2.835 N Pcnx n/a
8 TRCN0000189643 CTGTCCTTTAACGCTGCGTTT pLKO.1 1624 CDS 100% 4.050 2.835 N Pcnx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.