Transcript: Mouse XM_017315331.1

PREDICTED: Mus musculus PAP associated domain containing 4 (Papd4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Papd4 (100715)
Length:
2946
CDS:
195..1637

Additional Resources:

NCBI RefSeq record:
XM_017315331.1
NBCI Gene record:
Papd4 (100715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279028 ACTAGACTGTCTGGCTATATT pLKO_005 924 CDS 100% 15.000 21.000 N Papd4 n/a
2 TRCN0000178822 CGTTGTTTCACACGCACTATA pLKO.1 550 CDS 100% 13.200 18.480 N Papd4 n/a
3 TRCN0000183864 CCGTTGGAATTAGAAATACAT pLKO.1 1036 CDS 100% 5.625 4.500 N Papd4 n/a
4 TRCN0000179206 GCACGACATATACTCACCTTA pLKO.1 885 CDS 100% 4.950 3.960 N Papd4 n/a
5 TRCN0000279092 GCACGACATATACTCACCTTA pLKO_005 885 CDS 100% 4.950 3.960 N Papd4 n/a
6 TRCN0000279093 GAAGCAGTGATGGCGATTTAT pLKO_005 823 CDS 100% 15.000 10.500 N Papd4 n/a
7 TRCN0000297613 CCATTAGTGCTGGTGATTAAG pLKO_005 1098 CDS 100% 13.200 9.240 N Papd4 n/a
8 TRCN0000279094 CTGGTCTCTAATTCTTCAATT pLKO_005 1638 CDS 100% 13.200 9.240 N Papd4 n/a
9 TRCN0000195777 CCCTCCTTACCTCTCAAAGAA pLKO.1 1310 CDS 100% 5.625 3.938 N Papd4 n/a
10 TRCN0000007615 CCTGATGATATGGAATGGAAA pLKO.1 1440 CDS 100% 4.950 2.970 N SUGT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.