Transcript: Mouse XM_017315417.1

PREDICTED: Mus musculus NLR family, apoptosis inhibitory protein 5 (Naip5), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Naip5 (17951)
Length:
4493
CDS:
215..3634

Additional Resources:

NCBI RefSeq record:
XM_017315417.1
NBCI Gene record:
Naip5 (17951)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114741 GCTACAATGAACAGTGCCTTT pLKO.1 3873 3UTR 100% 4.050 2.835 N Naip5 n/a
2 TRCN0000339333 GAGGAAATTGCCCAGTATATT pLKO_005 122 5UTR 100% 15.000 7.500 Y Naip6 n/a
3 TRCN0000114745 CGCCAACAGTTGTATCTCATT pLKO.1 1836 CDS 100% 4.950 2.475 Y Naip5 n/a
4 TRCN0000114742 CGCTTGATTATCTTCTGGAAA pLKO.1 3578 CDS 100% 4.950 2.475 Y Naip5 n/a
5 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 4368 3UTR 100% 2.640 1.320 Y Adsl n/a
6 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 4368 3UTR 100% 2.640 1.320 Y Adsl n/a
7 TRCN0000114744 CAGTATATTCAAAGCTACGAA pLKO.1 134 5UTR 100% 3.000 1.800 N Naip5 n/a
8 TRCN0000339398 CTTACAGCCACCAGCTATAAA pLKO_005 2242 CDS 100% 15.000 7.500 Y Naip6 n/a
9 TRCN0000114757 CCCTTCTATAATACTGTCTTT pLKO.1 1229 CDS 100% 4.950 2.475 Y Naip6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315417.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.