Transcript: Mouse XM_017315510.2

PREDICTED: Mus musculus zinc finger protein 458 (Zfp458), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zfp458 (238690)
Length:
7370
CDS:
646..3018

Additional Resources:

NCBI RefSeq record:
XM_017315510.2
NBCI Gene record:
Zfp458 (238690)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000447291 AGTGGAAAGACCCTTGATTAT pLKO_005 2611 CDS 100% 13.200 18.480 N Zfp458 n/a
2 TRCN0000444708 CCGAAATCCATCAAGACTTTC pLKO_005 2793 CDS 100% 10.800 7.560 N Zfp458 n/a
3 TRCN0000444421 TTCCATTGTCTATCAACATTG pLKO_005 2371 CDS 100% 10.800 7.560 N Zfp458 n/a
4 TRCN0000095791 CCCTACAAGTCTGAAGATTAT pLKO.1 1249 CDS 100% 13.200 7.920 N Zfp458 n/a
5 TRCN0000095790 CCATCATTACTTTCTGCACAT pLKO.1 1120 CDS 100% 4.050 2.430 N Zfp458 n/a
6 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 1490 CDS 100% 13.200 6.600 Y Zfp992 n/a
7 TRCN0000085307 GCCTTCCACTTTCCATCATTA pLKO.1 2200 CDS 100% 13.200 6.600 Y Zfp65 n/a
8 TRCN0000096046 CAAATACAAGAGCCTTCAGAT pLKO.1 934 CDS 100% 4.950 2.475 Y Zfp738 n/a
9 TRCN0000095792 CTGGTCACATTTCTGGAACAA pLKO.1 916 CDS 100% 4.950 2.475 Y Zfp458 n/a
10 TRCN0000095789 CCATCAAGACTTTCCAACCAT pLKO.1 1372 CDS 100% 3.000 1.500 Y Zfp458 n/a
11 TRCN0000096044 CTGGAGAATTACAGCAACCTT pLKO.1 862 CDS 100% 3.000 1.500 Y Zfp738 n/a
12 TRCN0000095793 CCTTCAGATGTGAAGAGACAA pLKO.1 946 CDS 100% 0.495 0.248 Y Zfp458 n/a
13 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 853 CDS 100% 15.000 7.500 Y ZNF765 n/a
14 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1487 CDS 100% 10.800 5.400 Y Gm14308 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.