Transcript: Mouse XM_017315557.1

PREDICTED: Mus musculus predicted gene 10324 (Gm10324), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm10324 (628709)
Length:
2250
CDS:
123..2189

Additional Resources:

NCBI RefSeq record:
XM_017315557.1
NBCI Gene record:
Gm10324 (628709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 414 CDS 100% 15.000 7.500 Y Gm10771 n/a
2 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 414 CDS 100% 15.000 7.500 Y ZNF286B n/a
3 TRCN0000235275 CAGTAATCTCAGATATCATAA pLKO_005 551 CDS 100% 13.200 6.600 Y Gm10771 n/a
4 TRCN0000235272 TTACTTCTATAGGCTACAAAT pLKO_005 241 CDS 100% 13.200 6.600 Y Gm10771 n/a
5 TRCN0000235274 ATACTGGAGAGAGACCTTATG pLKO_005 496 CDS 100% 10.800 5.400 Y Gm10771 n/a
6 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 583 CDS 100% 5.625 2.813 Y ZNF345 n/a
7 TRCN0000095712 CCTTACTTCTATAGGCTACAA pLKO.1 239 CDS 100% 4.950 2.475 Y 2410141K09Rik n/a
8 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 665 CDS 100% 15.000 7.500 Y Zfp984 n/a
9 TRCN0000226021 GAGAACCCTCATTATTGTAAT pLKO_005 2099 CDS 100% 13.200 6.600 Y Gm10139 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.