Transcript: Mouse XM_017315578.1

PREDICTED: Mus musculus zinc finger protein 169 (Zfp169), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp169 (67911)
Length:
8383
CDS:
143..2341

Additional Resources:

NCBI RefSeq record:
XM_017315578.1
NBCI Gene record:
Zfp169 (67911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095649 GCTGGAAGTTTCACTTTCATA pLKO.1 2537 3UTR 100% 5.625 3.938 N Zfp169 n/a
2 TRCN0000095650 GCCTTTGAGTTTAAGTCTCTT pLKO.1 2120 CDS 100% 4.950 3.465 N Zfp169 n/a
3 TRCN0000095653 CGAGCCTTTGAGTTTAAGTCT pLKO.1 2117 CDS 100% 3.000 2.100 N Zfp169 n/a
4 TRCN0000095652 CATGTCAAGATCAGGCAGCAT pLKO.1 645 CDS 100% 2.640 1.848 N Zfp169 n/a
5 TRCN0000095651 CTGGTGAGAAACCTCACGTTT pLKO.1 1323 CDS 100% 0.495 0.347 N Zfp169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.