Transcript: Mouse XM_017315584.1

PREDICTED: Mus musculus leucine rich repeat containing 16A (Lrrc16a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Carmil1 (68732)
Length:
5287
CDS:
170..4441

Additional Resources:

NCBI RefSeq record:
XM_017315584.1
NBCI Gene record:
Carmil1 (68732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099281 CGGGATTGACATTCTTAACAA pLKO.1 2659 CDS 100% 5.625 3.938 N Carmil1 n/a
2 TRCN0000099282 CCTCCGTCTTTCAAGCAGTTT pLKO.1 1406 CDS 100% 4.950 3.465 N Carmil1 n/a
3 TRCN0000099283 CCGGGAGTTAATGGAAAGCAT pLKO.1 196 CDS 100% 3.000 2.100 N Carmil1 n/a
4 TRCN0000099280 GCTTTCTTCTTTCTCTCCTTT pLKO.1 4532 3UTR 100% 4.950 2.970 N Carmil1 n/a
5 TRCN0000162103 CCCAGGAGTATCAAGAACAAA pLKO.1 4332 CDS 100% 5.625 3.938 N CARMIL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.