Transcript: Mouse XM_017315652.1

PREDICTED: Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6c (Serpinb6c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Serpinb6c (97848)
Length:
1474
CDS:
225..1364

Additional Resources:

NCBI RefSeq record:
XM_017315652.1
NBCI Gene record:
Serpinb6c (97848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080387 GTTACTTCTCAGCGAAGTGAA pLKO.1 452 CDS 100% 0.495 0.693 N Serpinb6c n/a
2 TRCN0000080383 CTGTCCAATGTCATACATAAA pLKO.1 1170 CDS 100% 13.200 9.240 N Serpinb6c n/a
3 TRCN0000080384 TCCAGGTACAATACATTCAAA pLKO.1 686 CDS 100% 5.625 3.938 N Serpinb6c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.