Transcript: Mouse XM_017315983.1

PREDICTED: Mus musculus protocadherin 17 (Pcdh17), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcdh17 (219228)
Length:
9901
CDS:
2423..5893

Additional Resources:

NCBI RefSeq record:
XM_017315983.1
NBCI Gene record:
Pcdh17 (219228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094743 CTGTCAAGTGTAAACGGGAAA pLKO.1 4596 CDS 100% 4.050 5.670 N Pcdh17 n/a
2 TRCN0000094741 CGACGTGTCTATTTACACCTA pLKO.1 3967 CDS 100% 2.640 3.696 N Pcdh17 n/a
3 TRCN0000094740 CCCACAGTTGAAGCTAATGTT pLKO.1 5339 CDS 100% 5.625 4.500 N Pcdh17 n/a
4 TRCN0000094742 CCACTCGAACAAGAACCAGAA pLKO.1 5198 CDS 100% 4.050 3.240 N Pcdh17 n/a
5 TRCN0000056313 GCCACTCGGATGTCCATAATT pLKO.1 4958 CDS 100% 15.000 10.500 N PCDH17 n/a
6 TRCN0000056317 CCACGTTTAAGGACCCAGAAA pLKO.1 5043 CDS 100% 4.950 3.465 N PCDH17 n/a
7 TRCN0000094739 CCCATACAAAGCAGGGTCATA pLKO.1 6296 3UTR 100% 4.950 3.465 N Pcdh17 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8915 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315983.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.