Transcript: Mouse XM_017316012.1

PREDICTED: Mus musculus leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 (Lrit1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrit1 (239037)
Length:
4359
CDS:
147..2012

Additional Resources:

NCBI RefSeq record:
XM_017316012.1
NBCI Gene record:
Lrit1 (239037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125139 CCAACCTCTATACTCTTACAT pLKO.1 2764 3UTR 100% 5.625 3.938 N Lrit1 n/a
2 TRCN0000136610 CATCTGCCAAGCCAAGAACTT pLKO.1 1118 CDS 100% 4.950 3.465 N LRIT1 n/a
3 TRCN0000125143 CTCTCAAGGTAGTAGGAGATA pLKO.1 1438 CDS 100% 4.950 3.465 N Lrit1 n/a
4 TRCN0000125140 GCATCGAGACATGAGAAGGAT pLKO.1 1541 CDS 100% 3.000 2.100 N Lrit1 n/a
5 TRCN0000125141 CTGGGTTTCTTCAAACCTGAT pLKO.1 791 CDS 100% 0.405 0.284 N Lrit1 n/a
6 TRCN0000125142 GCTGGGTTTCTTCAAACCTGA pLKO.1 790 CDS 100% 0.264 0.185 N Lrit1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.