Transcript: Mouse XM_017316053.1

PREDICTED: Mus musculus ring finger protein 17 (Rnf17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf17 (30054)
Length:
5618
CDS:
68..4990

Additional Resources:

NCBI RefSeq record:
XM_017316053.1
NBCI Gene record:
Rnf17 (30054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240788 TGATATGCACTGCGCTGTTAA pLKO_005 3031 CDS 100% 13.200 18.480 N Rnf17 n/a
2 TRCN0000216253 CTGTTAGATTTGTACCACTTC pLKO.1 5439 3UTR 100% 4.050 5.670 N Rnf17 n/a
3 TRCN0000240784 ATGATGGTGAACAGCATATTA pLKO_005 1761 CDS 100% 15.000 10.500 N Rnf17 n/a
4 TRCN0000240785 CACTTCTATGTGCGGAAATAT pLKO_005 1427 CDS 100% 15.000 10.500 N Rnf17 n/a
5 TRCN0000240787 TGGTGACGATGGAACTATATT pLKO_005 3691 CDS 100% 15.000 10.500 N Rnf17 n/a
6 TRCN0000191077 CTCAAGAATATACCACAAGTA pLKO.1 249 CDS 100% 4.950 3.465 N Rnf17 n/a
7 TRCN0000192787 GACTCAGATTATCCGGACTTT pLKO.1 829 CDS 100% 4.950 3.465 N Rnf17 n/a
8 TRCN0000192650 GCTTCTCTTGATTCCAGGAAA pLKO.1 647 CDS 100% 4.950 3.465 N Rnf17 n/a
9 TRCN0000240786 GCTCCTGCAGCTGTCCAGAAA pLKO_005 5409 3UTR 100% 1.650 1.155 N Rnf17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.