Transcript: Mouse XM_017316086.1

PREDICTED: Mus musculus chymase 2, mast cell (Cma2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cma2 (545055)
Length:
862
CDS:
22..762

Additional Resources:

NCBI RefSeq record:
XM_017316086.1
NBCI Gene record:
Cma2 (545055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087739 GAAGGAAAGGTTATGTGGCAA pLKO.1 146 CDS 100% 2.640 1.848 N Mcptl n/a
2 TRCN0000032476 GCTGGAGCTGAGGAGATTATT pLKO.1 67 CDS 100% 15.000 7.500 Y Mcpt9 n/a
3 TRCN0000031432 GAATGCACACAGCAGAAGATA pLKO.1 271 CDS 100% 5.625 2.813 Y Cma2 n/a
4 TRCN0000031430 CCAAGTTCAATGACATCGTAT pLKO.1 335 CDS 100% 4.950 2.475 Y Cma2 n/a
5 TRCN0000087741 CCTATGTGAATACCTTCAGAA pLKO.1 128 CDS 100% 4.950 2.475 Y Mcptl n/a
6 TRCN0000221466 GCCCTGGATCAATAAGATCTT pLKO.1 729 CDS 100% 4.950 2.475 Y Cma1 n/a
7 TRCN0000032477 GAGGAGATTATTGGTGGTGTT pLKO.1 76 CDS 100% 4.050 2.025 Y Mcpt9 n/a
8 TRCN0000031433 CCTCCAAATTACAATGTGTCT pLKO.1 313 CDS 100% 2.640 1.320 Y Cma2 n/a
9 TRCN0000032475 CCTATGTGAATACCTTCAGTA pLKO.1 128 CDS 100% 4.950 2.475 Y Mcpt9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.