Transcript: Mouse XM_017316244.1

PREDICTED: Mus musculus predicted gene 626 (Gm626), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Frmpd2 (268729)
Length:
6275
CDS:
185..4063

Additional Resources:

NCBI RefSeq record:
XM_017316244.1
NBCI Gene record:
Frmpd2 (268729)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080571 CCTGATGACATGGAATTAATA pLKO.1 2738 CDS 100% 15.000 12.000 N Frmpd2 n/a
2 TRCN0000080572 CCCTGAACTATCAGGAGATCA pLKO.1 3673 CDS 100% 0.495 0.396 N Frmpd2 n/a
3 TRCN0000265796 CCATTGCAGCTGGTGACATTA pLKO_005 3507 CDS 100% 13.200 9.240 N FRMPD2B n/a
4 TRCN0000256105 ACATTATCCTGGCCGTGAATG pLKO_005 3522 CDS 100% 10.800 7.560 N FRMPD2B n/a
5 TRCN0000082786 GTGAGGATTAAGAGGCTCTTT pLKO.1 3458 CDS 100% 4.950 3.465 N FRMPD2 n/a
6 TRCN0000080568 GTCTGAATCTTTCTCTTGCAT pLKO.1 4157 3UTR 100% 3.000 2.100 N Frmpd2 n/a
7 TRCN0000080570 GCACGTCTATTCCTTAGGGAT pLKO.1 469 CDS 100% 2.640 1.848 N Frmpd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.