Transcript: Mouse XM_017316248.1

PREDICTED: Mus musculus predicted gene 2832 (Gm2832), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm2832 (100040545)
Length:
1903
CDS:
534..1286

Additional Resources:

NCBI RefSeq record:
XM_017316248.1
NBCI Gene record:
Gm2832 (100040545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347798 TAGTCTTGGGTGTCCATATTT pLKO_005 1497 3UTR 100% 15.000 7.500 Y Gm8267 n/a
2 TRCN0000347874 TGCAATGAATAGCCCTTAATT pLKO_005 1275 CDS 100% 15.000 7.500 Y Gm8267 n/a
3 TRCN0000197855 GATTCCTACAGGTGTGAAATA pLKO.1 1095 CDS 100% 13.200 6.600 Y 4930503E14Rik n/a
4 TRCN0000270589 TTGCAACATCACTAATCATAT pLKO_005 839 CDS 100% 13.200 6.600 Y Gm7247 n/a
5 TRCN0000201017 CCCAGTAATCATGGCTATCAT pLKO.1 1221 CDS 100% 5.625 2.813 Y Gm5622 n/a
6 TRCN0000198703 CAAGACCAAGGCAGAAGGAAT pLKO.1 736 CDS 100% 4.950 2.475 Y 4930503E14Rik n/a
7 TRCN0000192160 CACAACATGAGAAGACAATGT pLKO.1 1003 CDS 100% 4.950 2.475 Y Gm3696 n/a
8 TRCN0000176722 CATAGAAGATAAGGATTCCTA pLKO.1 1082 CDS 100% 3.000 1.500 Y 4930503E14Rik n/a
9 TRCN0000176818 GAAGATAAATGCTGAGAGGTT pLKO.1 902 CDS 100% 2.640 1.320 Y Gm9732 n/a
10 TRCN0000200690 GCAACATCACTAATCATATGA pLKO.1 841 CDS 100% 0.000 0.000 Y 1700024B05Rik n/a
11 TRCN0000177036 GAAGACAATGTTGGATATGAA pLKO.1 1013 CDS 100% 5.625 2.813 Y Gm10128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.