Transcript: Mouse XM_017316534.1

PREDICTED: Mus musculus transmembrane protein 71 (Tmem71), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem71 (213068)
Length:
2925
CDS:
551..1297

Additional Resources:

NCBI RefSeq record:
XM_017316534.1
NBCI Gene record:
Tmem71 (213068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429344 GGCTGCATGGAAGTATCTTTG pLKO_005 936 CDS 100% 10.800 8.640 N TMEM71 n/a
2 TRCN0000191349 CAAGGAGAACTTAGTTAGAAT pLKO.1 847 CDS 100% 5.625 3.938 N Tmem71 n/a
3 TRCN0000350122 CAAGGAGAACTTAGTTAGAAT pLKO_005 847 CDS 100% 5.625 3.938 N Tmem71 n/a
4 TRCN0000190106 GAGAAGTTGACTCACTCCCAA pLKO.1 957 CDS 100% 2.640 1.848 N Tmem71 n/a
5 TRCN0000319804 GAGAAGTTGACTCACTCCCAA pLKO_005 957 CDS 100% 2.640 1.848 N Tmem71 n/a
6 TRCN0000202070 CAGTAGCAAATGACTCCAGGT pLKO.1 582 CDS 100% 2.160 1.512 N Tmem71 n/a
7 TRCN0000350187 CAGTAGCAAATGACTCCAGGT pLKO_005 582 CDS 100% 2.160 1.512 N Tmem71 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.