Transcript: Mouse XM_017316640.1

PREDICTED: Mus musculus gasdermin C3 (Gsdmc3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gsdmc3 (270328)
Length:
2952
CDS:
944..2386

Additional Resources:

NCBI RefSeq record:
XM_017316640.1
NBCI Gene record:
Gsdmc3 (270328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121510 GCTCAGTGATAGCCAACTCAA pLKO.1 2035 CDS 100% 4.950 3.465 N Gsdmc3 n/a
2 TRCN0000417258 GCCTCCGACCTGGATACATTT pLKO_005 2364 CDS 100% 13.200 7.920 N Gsdmc3 n/a
3 TRCN0000419511 TGATGCTATGCTACGTTTAAT pLKO_005 2614 3UTR 100% 15.000 7.500 Y Gsdmc3 n/a
4 TRCN0000121508 GCAACCAAATTCCGCCTATTT pLKO.1 1031 CDS 100% 13.200 6.600 Y Gsdmc3 n/a
5 TRCN0000121511 GCAACCCATGTGTTGACCTAA pLKO.1 1977 CDS 100% 4.950 2.475 Y Gsdmc3 n/a
6 TRCN0000121509 GCCTATAAGAAGCAGCAACTT pLKO.1 1556 CDS 100% 4.950 2.475 Y Gsdmc3 n/a
7 TRCN0000198581 GCCTATAAGAAGCAGCAACTT pLKO.1 1556 CDS 100% 4.950 2.475 Y Gsdmc2 n/a
8 TRCN0000181281 CCAGTGGGAATAAAGATGCTA pLKO.1 2439 3UTR 100% 3.000 1.500 Y Gsdmc2 n/a
9 TRCN0000121507 CCTCCATTCTTGTGGAATGTT pLKO.1 2750 3UTR 100% 0.563 0.281 Y Gsdmc3 n/a
10 TRCN0000178653 CCTCAACAACTTCTCATTCAT pLKO.1 2577 3UTR 100% 5.625 2.813 Y Gsdmc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.