Transcript: Mouse XM_017316858.1

PREDICTED: Mus musculus CD80 antigen (Cd80), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd80 (12519)
Length:
1450
CDS:
440..1102

Additional Resources:

NCBI RefSeq record:
XM_017316858.1
NBCI Gene record:
Cd80 (12519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067894 CCGAGTATAAGAACCGGACTT pLKO.1 729 CDS 100% 4.050 5.670 N Cd80 n/a
2 TRCN0000067896 CGTTGTCATCATCAAATGCTT pLKO.1 973 CDS 100% 3.000 4.200 N Cd80 n/a
3 TRCN0000067897 AGTCAGTGAAAGATAAGGTAT pLKO.1 594 CDS 100% 4.950 3.960 N Cd80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.