Transcript: Mouse XM_017316947.1

PREDICTED: Mus musculus scaffolding protein involved in DNA repair (Spidr), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spidr (224008)
Length:
3240
CDS:
960..2834

Additional Resources:

NCBI RefSeq record:
XM_017316947.1
NBCI Gene record:
Spidr (224008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307577 ACCTATACAGTCCGGACATAT pLKO_005 1285 CDS 100% 13.200 18.480 N Spidr n/a
2 TRCN0000104164 GCAGAGCAACATCTTATAGTT pLKO.1 1440 CDS 100% 5.625 7.875 N Spidr n/a
3 TRCN0000288257 GCAGAGCAACATCTTATAGTT pLKO_005 1440 CDS 100% 5.625 7.875 N Spidr n/a
4 TRCN0000104161 GCTCCATTATTCTGAATACTT pLKO.1 1222 CDS 100% 5.625 7.875 N Spidr n/a
5 TRCN0000295548 TTCTGGTAAAGAGATTAATAG pLKO_005 2915 3UTR 100% 13.200 10.560 N Spidr n/a
6 TRCN0000104160 GCTTAGGAAATGTGCTTTGTT pLKO.1 3067 3UTR 100% 5.625 4.500 N Spidr n/a
7 TRCN0000295491 GAAGATGAATTACAGGTTATT pLKO_005 462 5UTR 100% 13.200 9.240 N Spidr n/a
8 TRCN0000295492 TCCGAAGACTCCAGAATATTC pLKO_005 827 5UTR 100% 13.200 9.240 N Spidr n/a
9 TRCN0000104163 CCAGAGGTTGTAGAAGAACTT pLKO.1 2196 CDS 100% 4.950 3.465 N Spidr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.