Transcript: Mouse XM_017316950.1

PREDICTED: Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 (Slc7a4), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc7a4 (224022)
Length:
2648
CDS:
410..2317

Additional Resources:

NCBI RefSeq record:
XM_017316950.1
NBCI Gene record:
Slc7a4 (224022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079511 GCCCTATGCTATGCAGAGTTT pLKO.1 665 CDS 100% 4.950 6.930 N Slc7a4 n/a
2 TRCN0000079510 CCTAGCTCACTATCCAGATTT pLKO.1 901 CDS 100% 13.200 9.240 N Slc7a4 n/a
3 TRCN0000079512 TGGCTCTATCTGTGCCATGAA pLKO.1 1378 CDS 100% 4.950 3.465 N Slc7a4 n/a
4 TRCN0000079508 GCTGCCTACTTAAGGAAGCTT pLKO.1 2383 3UTR 100% 3.000 2.100 N Slc7a4 n/a
5 TRCN0000079509 GCATTCCTCATAGGCTGGAAT pLKO.1 752 CDS 100% 0.495 0.297 N Slc7a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.