Transcript: Mouse XM_017316960.1

PREDICTED: Mus musculus transmembrane protein 44 (Tmem44), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem44 (224090)
Length:
4136
CDS:
437..1546

Additional Resources:

NCBI RefSeq record:
XM_017316960.1
NBCI Gene record:
Tmem44 (224090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257790 CTACCTAGCAGCTGTCGATTT pLKO_005 415 5UTR 100% 10.800 15.120 N Tmem44 n/a
2 TRCN0000247296 CTTTCTGTCCTGCGTGATAAA pLKO_005 922 CDS 100% 13.200 10.560 N Tmem44 n/a
3 TRCN0000247295 TCATGACCGGCAGCCTGAATA pLKO_005 835 CDS 100% 13.200 10.560 N Tmem44 n/a
4 TRCN0000247294 GATCCCTCCATTCTCCAATAT pLKO_005 724 CDS 100% 13.200 9.240 N Tmem44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.