Transcript: Mouse XM_017316970.1

PREDICTED: Mus musculus interphotoreceptor matrix proteoglycan 2 (Impg2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Impg2 (224224)
Length:
6105
CDS:
1270..5013

Additional Resources:

NCBI RefSeq record:
XM_017316970.1
NBCI Gene record:
Impg2 (224224)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125857 CGCGTGACAAACATGTTGTTT pLKO.1 3892 CDS 100% 5.625 7.875 N Impg2 n/a
2 TRCN0000125858 CCGCGTGACAAACATGTTGTT pLKO.1 3891 CDS 100% 4.950 6.930 N Impg2 n/a
3 TRCN0000125855 CGATGGAAAGTGTGACATTAT pLKO.1 4365 CDS 100% 13.200 10.560 N Impg2 n/a
4 TRCN0000125856 GCGATCTATTCTGTTCCCAAA pLKO.1 1386 CDS 100% 4.050 2.835 N Impg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.