Transcript: Mouse XM_017317202.1

PREDICTED: Mus musculus DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 (Dhx57), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhx57 (106794)
Length:
3860
CDS:
142..3219

Additional Resources:

NCBI RefSeq record:
XM_017317202.1
NBCI Gene record:
Dhx57 (106794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345271 CAGCTCTTGATCCGTTATAAA pLKO_005 2551 CDS 100% 15.000 21.000 N Dhx57 n/a
2 TRCN0000313232 GCAGCTCTTGATCCGTTATAA pLKO_005 2550 CDS 100% 15.000 21.000 N Dhx57 n/a
3 TRCN0000113032 GCATCAATTATCGTGGAGAAT pLKO.1 1603 CDS 100% 4.950 6.930 N Dhx57 n/a
4 TRCN0000313157 CACCCGCTGCACTCATCATTA pLKO_005 2797 CDS 100% 13.200 9.240 N Dhx57 n/a
5 TRCN0000113031 CCACAGTTTATCCTGGATAAT pLKO.1 1876 CDS 100% 13.200 9.240 N Dhx57 n/a
6 TRCN0000113033 GCTGGACAAGAGCCTATCTTT pLKO.1 592 CDS 100% 5.625 3.938 N Dhx57 n/a
7 TRCN0000345340 ACATTGCTGAGACGTCTATAA pLKO_005 2888 CDS 100% 13.200 7.920 N Dhx57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.