Transcript: Mouse XM_017317291.1

PREDICTED: Mus musculus methylmalonyl-Coenzyme A mutase (Mut), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mut (17850)
Length:
3057
CDS:
267..1763

Additional Resources:

NCBI RefSeq record:
XM_017317291.1
NBCI Gene record:
Mut (17850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215457 GACTCACAATTGATGAATTTG pLKO.1 394 CDS 100% 13.200 18.480 N Mut n/a
2 TRCN0000177151 GCATAAAGCTAATGATCGTAT pLKO.1 1235 CDS 100% 4.950 6.930 N Mut n/a
3 TRCN0000216418 GCTGCTCTGAAGTTGATATAT pLKO.1 831 CDS 100% 15.000 10.500 N Mut n/a
4 TRCN0000177436 CCACCACAGGATTATGAATTT pLKO.1 1626 CDS 100% 13.200 9.240 N Mut n/a
5 TRCN0000049040 GCCCGAAGACAAGCTAGAATA pLKO.1 927 CDS 100% 13.200 9.240 N MMUT n/a
6 TRCN0000327912 GCCCGAAGACAAGCTAGAATA pLKO_005 927 CDS 100% 13.200 9.240 N MMUT n/a
7 TRCN0000198519 GCTCCTCACATGGGAATGATA pLKO.1 2506 3UTR 100% 5.625 3.938 N Mut n/a
8 TRCN0000178183 CAAGGTCATTGCTACAGGATT pLKO.1 1403 CDS 100% 4.950 3.465 N Mut n/a
9 TRCN0000178133 GCTACAGGATTTGCTGATCTT pLKO.1 1413 CDS 100% 4.950 3.465 N Mut n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.