Transcript: Mouse XM_017317334.1

PREDICTED: Mus musculus polycystic kidney disease 1 homolog (Pkd1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkd1 (18763)
Length:
14204
CDS:
259..13260

Additional Resources:

NCBI RefSeq record:
XM_017317334.1
NBCI Gene record:
Pkd1 (18763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304612 ACACAATACCACGCATATTTA pLKO_005 3510 CDS 100% 15.000 21.000 N Pkd1 n/a
2 TRCN0000072083 CGCTCGCACTTTCAGCAATAA pLKO.1 7470 CDS 100% 13.200 18.480 N Pkd1 n/a
3 TRCN0000331808 CGCTCGCACTTTCAGCAATAA pLKO_005 7470 CDS 100% 13.200 18.480 N Pkd1 n/a
4 TRCN0000304664 GGTGGACACCACTCAGTATTA pLKO_005 13329 3UTR 100% 13.200 18.480 N Pkd1 n/a
5 TRCN0000304611 CAACTGATGGTGTCCTATATA pLKO_005 3704 CDS 100% 15.000 12.000 N Pkd1 n/a
6 TRCN0000072086 CCAACTCAACATCACCGTAAA pLKO.1 4860 CDS 100% 10.800 7.560 N Pkd1 n/a
7 TRCN0000072084 GCCCTGTACCTTTCAACCAAT pLKO.1 2458 CDS 100% 4.950 3.465 N Pkd1 n/a
8 TRCN0000072085 CCATCATTGAAGGTGGCTCAT pLKO.1 7025 CDS 100% 4.050 2.835 N Pkd1 n/a
9 TRCN0000072087 GCTTCACTACTCTTCCTGCTT pLKO.1 12322 CDS 100% 2.640 1.848 N Pkd1 n/a
10 TRCN0000302260 GCTTCACTACTCTTCCTGCTT pLKO_005 12322 CDS 100% 2.640 1.848 N Pkd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.