Transcript: Mouse XM_017317349.1

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, S (Ptprs), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptprs (19280)
Length:
6078
CDS:
151..5187

Additional Resources:

NCBI RefSeq record:
XM_017317349.1
NBCI Gene record:
Ptprs (19280)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238012 CACCCATGCCCTACGTGAAAT pLKO_005 209 CDS 100% 13.200 18.480 N Ptprs n/a
2 TRCN0000238010 CCGTGTCCTACTACGTAATTG pLKO_005 473 CDS 100% 13.200 18.480 N Ptprs n/a
3 TRCN0000220478 CCAGCTTTATCGACGGCTATA pLKO.1 4553 CDS 100% 10.800 15.120 N Ptprs n/a
4 TRCN0000238011 TCAAGCCCAATACGGAGTATG pLKO_005 1148 CDS 100% 10.800 15.120 N Ptprs n/a
5 TRCN0000220481 CCACGGCCATATTGGTAAGTT pLKO.1 1292 CDS 100% 5.625 7.875 N Ptprs n/a
6 TRCN0000257330 GAAGCGTGAGGTGCGACATTT pLKO_005 3969 CDS 100% 13.200 9.240 N Ptprs n/a
7 TRCN0000238009 GCTTCTGTGTGTGCATCTTTC pLKO_005 5645 3UTR 100% 10.800 7.560 N Ptprs n/a
8 TRCN0000220480 GCAGAACTACTTCATTGTGAT pLKO.1 2841 CDS 100% 4.950 3.465 N Ptprs n/a
9 TRCN0000220477 CCTTCCTCATTCCCTTCTGAT pLKO.1 5305 3UTR 100% 4.950 2.970 N Ptprs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.