Transcript: Mouse XM_017317407.1

PREDICTED: Mus musculus zinc finger, DHHC domain containing 14 (Zdhhc14), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc14 (224454)
Length:
1657
CDS:
103..939

Additional Resources:

NCBI RefSeq record:
XM_017317407.1
NBCI Gene record:
Zdhhc14 (224454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125754 CCGTTCCATTTGTTCATTAAA pLKO.1 1211 3UTR 100% 15.000 10.500 N Zdhhc14 n/a
2 TRCN0000179195 GTGCATTCAGAGCACCAAATT pLKO.1 552 CDS 100% 13.200 9.240 N ZDHHC14 n/a
3 TRCN0000125757 CCTGTCCTTTCTGACAGTCTT pLKO.1 117 CDS 100% 0.495 0.347 N Zdhhc14 n/a
4 TRCN0000125758 CAGTGCATTCAGAGCACCAAA pLKO.1 550 CDS 100% 4.950 2.970 N Zdhhc14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.