Transcript: Mouse XM_017317413.1

PREDICTED: Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 (Adamts10), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adamts10 (224697)
Length:
3388
CDS:
241..2808

Additional Resources:

NCBI RefSeq record:
XM_017317413.1
NBCI Gene record:
Adamts10 (224697)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374430 CAAATCGCGTCAGTGTAAATA pLKO_005 948 CDS 100% 15.000 21.000 N Adamts10 n/a
2 TRCN0000419865 CAAATCGCGTCAGTGTAAATA pLKO_005 948 CDS 100% 15.000 21.000 N ADAMTS10 n/a
3 TRCN0000312890 AGATGCAGTTGAAAGTTATTT pLKO_005 2900 3UTR 100% 15.000 10.500 N Adamts10 n/a
4 TRCN0000374409 CCATCTACTATGCGATGTAAC pLKO_005 2467 CDS 100% 10.800 7.560 N Adamts10 n/a
5 TRCN0000032248 GCAGTATGTGTTGGCCATCAT pLKO.1 276 CDS 100% 4.950 3.465 N Adamts10 n/a
6 TRCN0000311983 GCAGTATGTGTTGGCCATCAT pLKO_005 276 CDS 100% 4.950 3.465 N Adamts10 n/a
7 TRCN0000050330 GACAAGATGATGGTGGCCTAT pLKO.1 235 5UTR 100% 4.050 2.835 N ADAMTS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.