Transcript: Mouse XM_017317415.1

PREDICTED: Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 (Adamts10), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adamts10 (224697)
Length:
3980
CDS:
1283..3400

Additional Resources:

NCBI RefSeq record:
XM_017317415.1
NBCI Gene record:
Adamts10 (224697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374430 CAAATCGCGTCAGTGTAAATA pLKO_005 1540 CDS 100% 15.000 21.000 N Adamts10 n/a
2 TRCN0000419865 CAAATCGCGTCAGTGTAAATA pLKO_005 1540 CDS 100% 15.000 21.000 N ADAMTS10 n/a
3 TRCN0000312890 AGATGCAGTTGAAAGTTATTT pLKO_005 3492 3UTR 100% 15.000 10.500 N Adamts10 n/a
4 TRCN0000374409 CCATCTACTATGCGATGTAAC pLKO_005 3059 CDS 100% 10.800 7.560 N Adamts10 n/a
5 TRCN0000032248 GCAGTATGTGTTGGCCATCAT pLKO.1 773 5UTR 100% 4.950 3.465 N Adamts10 n/a
6 TRCN0000311983 GCAGTATGTGTTGGCCATCAT pLKO_005 773 5UTR 100% 4.950 3.465 N Adamts10 n/a
7 TRCN0000032245 CCCATGTAGTATACAAGCGTT pLKO.1 517 5UTR 100% 2.640 1.848 N Adamts10 n/a
8 TRCN0000032247 CTCACATTCAAGGTCACGCAT pLKO.1 240 5UTR 100% 2.640 1.848 N Adamts10 n/a
9 TRCN0000032246 GCTATGAGATTGCCTTCCCAA pLKO.1 301 5UTR 100% 2.640 1.848 N Adamts10 n/a
10 TRCN0000050330 GACAAGATGATGGTGGCCTAT pLKO.1 732 5UTR 100% 4.050 2.835 N ADAMTS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.