Transcript: Mouse XM_017317547.1

PREDICTED: Mus musculus plakophilin 4 (Pkp4), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkp4 (227937)
Length:
4558
CDS:
676..3801

Additional Resources:

NCBI RefSeq record:
XM_017317547.1
NBCI Gene record:
Pkp4 (227937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123360 GCACCCTTACATACCAAAGAA pLKO.1 1607 CDS 100% 5.625 7.875 N Pkp4 n/a
2 TRCN0000318016 GCACCCTTACATACCAAAGAA pLKO_005 1607 CDS 100% 5.625 7.875 N Pkp4 n/a
3 TRCN0000123362 CCAGCCACCTATGCAGTATTA pLKO.1 3420 CDS 100% 13.200 9.240 N Pkp4 n/a
4 TRCN0000314210 GTGTAGGTGTTAGATCTAATT pLKO_005 4006 3UTR 100% 13.200 9.240 N Pkp4 n/a
5 TRCN0000314153 TAGAGCGAGACCGATTCAAAT pLKO_005 3278 CDS 100% 13.200 9.240 N Pkp4 n/a
6 TRCN0000123363 GCAGAAGTAAGGGAGCTTGTT pLKO.1 2110 CDS 100% 4.950 3.465 N Pkp4 n/a
7 TRCN0000318017 GCAGAAGTAAGGGAGCTTGTT pLKO_005 2110 CDS 100% 4.950 3.465 N Pkp4 n/a
8 TRCN0000123359 GCTTTCCTTCTGACTCTGTTT pLKO.1 3829 3UTR 100% 4.950 3.465 N Pkp4 n/a
9 TRCN0000123361 CGGACTGAAATCAACCACGAA pLKO.1 3702 CDS 100% 2.640 1.848 N Pkp4 n/a
10 TRCN0000318018 CGGACTGAAATCAACCACGAA pLKO_005 3702 CDS 100% 2.640 1.848 N Pkp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.