Transcript: Mouse XM_017317646.1

PREDICTED: Mus musculus RAN binding protein 3 (Ranbp3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ranbp3 (71810)
Length:
3068
CDS:
527..2203

Additional Resources:

NCBI RefSeq record:
XM_017317646.1
NBCI Gene record:
Ranbp3 (71810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194571 CAGATGGATAAGGCCAGTGAA pLKO.1 1889 CDS 100% 4.950 6.930 N Ranbp3 n/a
2 TRCN0000174754 GAGAGACAGAGTGAAGTTAAT pLKO.1 1300 CDS 100% 13.200 9.240 N Ranbp3 n/a
3 TRCN0000352549 GAGAGACAGAGTGAAGTTAAT pLKO_005 1300 CDS 100% 13.200 9.240 N Ranbp3 n/a
4 TRCN0000341226 GGACTCAGACCTCATCATATT pLKO_005 2359 3UTR 100% 13.200 9.240 N Ranbp3 n/a
5 TRCN0000173856 GCTGACAACTCCACCAAGTTT pLKO.1 1442 CDS 100% 5.625 3.938 N Ranbp3 n/a
6 TRCN0000341158 GCTGACAACTCCACCAAGTTT pLKO_005 1442 CDS 100% 5.625 3.938 N Ranbp3 n/a
7 TRCN0000194506 GCTCAGCATTCTGTTGAGTAA pLKO.1 2492 3UTR 100% 4.950 3.465 N Ranbp3 n/a
8 TRCN0000173419 GAAGATTCTGACCATGAGGAT pLKO.1 998 CDS 100% 2.640 1.848 N Ranbp3 n/a
9 TRCN0000341157 GAAGATTCTGACCATGAGGAT pLKO_005 998 CDS 100% 2.640 1.848 N Ranbp3 n/a
10 TRCN0000173692 CCAAAGCTGAATGAAGCCAAT pLKO.1 1502 CDS 100% 4.050 2.430 N Ranbp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.