Transcript: Mouse XM_017317694.1

PREDICTED: Mus musculus zinc finger protein 946 (Zfp946), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp946 (74149)
Length:
3609
CDS:
1187..2758

Additional Resources:

NCBI RefSeq record:
XM_017317694.1
NBCI Gene record:
Zfp946 (74149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434853 TACTTTATCCAGGTGGTATTT pLKO_005 3023 3UTR 100% 13.200 18.480 N Zfp946 n/a
2 TRCN0000085066 GAGATACAACTGTTGAATCAT pLKO.1 1515 CDS 100% 5.625 7.875 N Zfp946 n/a
3 TRCN0000085065 TCACCCAGCTATGCGATCTTA pLKO.1 1770 CDS 100% 5.625 7.875 N Zfp946 n/a
4 TRCN0000085063 GCAGCTAATATACCTCTCAAA pLKO.1 3284 3UTR 100% 4.950 3.960 N Zfp946 n/a
5 TRCN0000422761 AGTCATCAGCGAAATCATATA pLKO_005 1793 CDS 100% 13.200 9.240 N Zfp946 n/a
6 TRCN0000085064 CCAGTTCATACAAGAGGGAAA pLKO.1 1886 CDS 100% 4.050 2.835 N Zfp946 n/a
7 TRCN0000436357 GTGTTCTATCATTAGTCTAAA pLKO_005 1612 CDS 100% 13.200 7.920 N Zfp946 n/a
8 TRCN0000085067 GCCAACTTATAATTCATCAGA pLKO.1 2202 CDS 100% 3.000 1.800 N Zfp946 n/a
9 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 2064 CDS 100% 13.200 6.600 Y Znf41-ps n/a
10 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 2064 CDS 100% 13.200 6.600 Y EG666605 n/a
11 TRCN0000225755 CCGGAGAGAAACCCTACAAAT pLKO_005 2232 CDS 100% 13.200 6.600 Y Zfp808 n/a
12 TRCN0000423260 GTGGAAAGAAACCTTACAAAT pLKO_005 1728 CDS 100% 13.200 6.600 Y Zfp946 n/a
13 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 1906 CDS 100% 10.800 5.400 Y Rex2 n/a
14 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 1738 CDS 100% 10.800 5.400 Y Rex2 n/a
15 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 1739 CDS 100% 13.200 6.600 Y Gm13212 n/a
16 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 1304 CDS 100% 13.200 6.600 Y Zfp874a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.