Transcript: Mouse XM_017317721.1

PREDICTED: Mus musculus FLYWCH family member 2 (Flywch2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Flywch2 (76917)
Length:
739
CDS:
234..653

Additional Resources:

NCBI RefSeq record:
XM_017317721.1
NBCI Gene record:
Flywch2 (76917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248129 CAGATGGTCCAGAAGACAATG pLKO_005 559 CDS 100% 10.800 7.560 N Flywch2 n/a
2 TRCN0000248130 CAAAGGAGTGCACTGCATCAT pLKO_005 410 CDS 100% 4.950 3.465 N Flywch2 n/a
3 TRCN0000248132 TCTGCTGACAGCCTCCAAAGA pLKO_005 362 CDS 100% 4.950 3.465 N Flywch2 n/a
4 TRCN0000257680 CAGGAAGCCCAGAAAGTTCTC pLKO_005 332 CDS 100% 4.050 2.835 N Flywch2 n/a
5 TRCN0000178743 CAGAAAGTTCTCCAAACTGGT pLKO.1 341 CDS 100% 2.640 1.848 N FLYWCH2 n/a
6 TRCN0000196056 GTTCTCCAAACTGGTTCTGCT pLKO.1 347 CDS 100% 2.640 1.848 N Flywch2 n/a
7 TRCN0000248131 TAAGGCCCTCCTCAAGACTCA pLKO_005 464 CDS 100% 2.640 1.848 N Flywch2 n/a
8 TRCN0000243357 GAAAGTTCTCCAAACTGGTCC pLKO_005 343 CDS 100% 2.160 1.512 N FLYWCH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.