Transcript: Mouse XM_017317849.1

PREDICTED: Mus musculus Niemann-Pick type C1 (Npc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npc1 (18145)
Length:
5045
CDS:
196..4026

Additional Resources:

NCBI RefSeq record:
XM_017317849.1
NBCI Gene record:
Npc1 (18145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321216 GAACAGTACCTGACCATTATT pLKO_005 3454 CDS 100% 15.000 21.000 N Npc1 n/a
2 TRCN0000012124 CCCGTCTTACTCAGTTACATA pLKO.1 3922 CDS 100% 5.625 7.875 N Npc1 n/a
3 TRCN0000321214 CCCGTCTTACTCAGTTACATA pLKO_005 3922 CDS 100% 5.625 7.875 N Npc1 n/a
4 TRCN0000012123 GCAGTATTAATGGATCTGAAA pLKO.1 4187 3UTR 100% 4.950 6.930 N Npc1 n/a
5 TRCN0000321215 GCAGTATTAATGGATCTGAAA pLKO_005 4187 3UTR 100% 4.950 6.930 N Npc1 n/a
6 TRCN0000012126 GCCAAACGATTCGTATGTGAT pLKO.1 2790 CDS 100% 4.950 6.930 N Npc1 n/a
7 TRCN0000350620 GCCAAACGATTCGTATGTGAT pLKO_005 2790 CDS 100% 4.950 6.930 N Npc1 n/a
8 TRCN0000012125 CCCGTGAATAATTACTACAAT pLKO.1 1888 CDS 100% 5.625 4.500 N Npc1 n/a
9 TRCN0000350621 GGAATCACACTTACGAAATTT pLKO_005 3790 CDS 100% 15.000 10.500 N Npc1 n/a
10 TRCN0000012127 CCCATGAGAAATGCCACCAAA pLKO.1 850 CDS 100% 4.950 2.970 N Npc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.