Transcript: Mouse XM_017317905.1

PREDICTED: Mus musculus family with sequence similarity 69, member C (Fam69c), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam69c (240479)
Length:
6913
CDS:
1011..1805

Additional Resources:

NCBI RefSeq record:
XM_017317905.1
NBCI Gene record:
Fam69c (240479)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217366 GACTTTACGGTGGTAGCTATT pLKO.1 1413 CDS 100% 10.800 15.120 N Fam69c n/a
2 TRCN0000182836 CCATGAGTGTATGAGTGGGTT pLKO.1 2210 3UTR 100% 2.640 3.696 N Fam69c n/a
3 TRCN0000177258 GAAGATTGCAATTTCTTCGAT pLKO.1 1500 CDS 100% 0.300 0.240 N Fam69c n/a
4 TRCN0000217202 CCAACAGGAGGAATACGTATA pLKO.1 1136 CDS 100% 10.800 7.560 N Fam69c n/a
5 TRCN0000178090 GCATGGGATTGTGTGTATGTA pLKO.1 2282 3UTR 100% 5.625 3.938 N Fam69c n/a
6 TRCN0000182498 GCACAGGCTATTAGCCACATT pLKO.1 1293 CDS 100% 4.950 3.465 N Fam69c n/a
7 TRCN0000200209 CCTCCTGTAGTTGCTATGCAA pLKO.1 1862 3UTR 100% 3.000 2.100 N Fam69c n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3777 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 3797 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.