Transcript: Mouse XM_017317996.1

PREDICTED: Mus musculus WD repeat domain 33 (Wdr33), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr33 (74320)
Length:
4717
CDS:
259..4287

Additional Resources:

NCBI RefSeq record:
XM_017317996.1
NBCI Gene record:
Wdr33 (74320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294668 CAGCCGGATGCAGGTTATTAT pLKO_005 505 CDS 100% 15.000 21.000 N Wdr33 n/a
2 TRCN0000123608 CCACGGATAATAAATTTGCTA pLKO.1 893 CDS 100% 3.000 4.200 N Wdr33 n/a
3 TRCN0000123604 GCTCCAAATGAGGTGCTGAAT pLKO.1 1807 CDS 100% 4.950 3.960 N Wdr33 n/a
4 TRCN0000306779 GCTCCAAATGAGGTGCTGAAT pLKO_005 1807 CDS 100% 4.950 3.960 N Wdr33 n/a
5 TRCN0000294667 TCCTGCTCCTCAAGGGTTAAT pLKO_005 2625 CDS 100% 13.200 9.240 N Wdr33 n/a
6 TRCN0000074841 GCACATAAGGAGGCGATTAGA pLKO.1 856 CDS 100% 5.625 3.938 N WDR33 n/a
7 TRCN0000123606 CGAAGGGATGATCTGGAGTTT pLKO.1 1380 CDS 100% 4.950 3.465 N Wdr33 n/a
8 TRCN0000332097 CGAAGGGATGATCTGGAGTTT pLKO_005 1380 CDS 100% 4.950 3.465 N Wdr33 n/a
9 TRCN0000123607 CCTGATGACTTCAGACCAGAT pLKO.1 3357 CDS 100% 4.050 2.835 N Wdr33 n/a
10 TRCN0000287289 CCTGATGACTTCAGACCAGAT pLKO_005 3357 CDS 100% 4.050 2.835 N Wdr33 n/a
11 TRCN0000123605 CCTGATGAGTTTCCTCGCTTT pLKO.1 3828 CDS 100% 4.050 2.835 N Wdr33 n/a
12 TRCN0000307391 ATGATGACCTGGAGCCTAATA pLKO_005 1547 CDS 100% 13.200 7.920 N Wdr33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.