Transcript: Mouse XM_017318047.1

PREDICTED: Mus musculus ectonucleoside triphosphate diphosphohydrolase 1 (Entpd1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Entpd1 (12495)
Length:
4080
CDS:
300..1508

Additional Resources:

NCBI RefSeq record:
XM_017318047.1
NBCI Gene record:
Entpd1 (12495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222348 CCGAACTGATACCAACATCCA pLKO.1 313 CDS 100% 2.640 2.112 N Entpd1 n/a
2 TRCN0000222344 CCAAGGACATTCAGGTTTCAA pLKO.1 772 CDS 100% 5.625 3.938 N Entpd1 n/a
3 TRCN0000222347 GCTCCTGGGAACAGATTCATT pLKO.1 1270 CDS 100% 5.625 3.938 N Entpd1 n/a
4 TRCN0000222346 CCCATGCTTTAACCCAGGATA pLKO.1 812 CDS 100% 4.950 3.465 N Entpd1 n/a
5 TRCN0000050288 CCTTCATATTTCTGGAAAGAT pLKO.1 1479 CDS 100% 5.625 3.938 N ENTPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.