Transcript: Mouse XM_017318062.1

PREDICTED: Mus musculus glucosaminyl (N-acetyl) transferase 1, core 2 (Gcnt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gcnt1 (14537)
Length:
4712
CDS:
482..1780

Additional Resources:

NCBI RefSeq record:
XM_017318062.1
NBCI Gene record:
Gcnt1 (14537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097617 CCAGTTGGAGAGTGTTGTTTA pLKO.1 1033 CDS 100% 13.200 9.240 N Gcnt1 n/a
2 TRCN0000097618 GTGGTATGGATTTCCCTATTA pLKO.1 1143 CDS 100% 13.200 9.240 N Gcnt1 n/a
3 TRCN0000097614 CCCTCTATACTGGCTTCTGAT pLKO.1 3422 3UTR 100% 4.950 3.465 N Gcnt1 n/a
4 TRCN0000035230 GCCATCTATATGCCTCAGAAT pLKO.1 917 CDS 100% 4.950 3.465 N GCNT1 n/a
5 TRCN0000097616 CCATCTATATGCCTCAGAATT pLKO.1 918 CDS 100% 0.000 0.000 N Gcnt1 n/a
6 TRCN0000097615 GCCAATAAGTTTGACATGGAT pLKO.1 1688 CDS 100% 3.000 1.800 N Gcnt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.