Transcript: Mouse XM_017318073.1

PREDICTED: Mus musculus latent transforming growth factor beta binding protein 3 (Ltbp3), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ltbp3 (16998)
Length:
4117
CDS:
667..3678

Additional Resources:

NCBI RefSeq record:
XM_017318073.1
NBCI Gene record:
Ltbp3 (16998)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304285 GATCGATCATCGAGGGTATTT pLKO_005 3706 3UTR 100% 13.200 10.560 N Ltbp3 n/a
2 TRCN0000065736 CCGCTACTGTGTTGATGTGAA pLKO.1 2490 CDS 100% 4.950 3.465 N Ltbp3 n/a
3 TRCN0000301493 CCGCTACTGTGTTGATGTGAA pLKO_005 2490 CDS 100% 4.950 3.465 N Ltbp3 n/a
4 TRCN0000065734 CCTGTCGTGATGTCAACGAAT pLKO.1 2879 CDS 100% 4.950 3.465 N Ltbp3 n/a
5 TRCN0000301561 CCTGTCGTGATGTCAACGAAT pLKO_005 2879 CDS 100% 4.950 3.465 N Ltbp3 n/a
6 TRCN0000065733 CCTTTAATTTACTCTTGGCTT pLKO.1 3915 3UTR 100% 2.640 1.848 N Ltbp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.