Transcript: Mouse XM_017318153.2

PREDICTED: Mus musculus transient receptor potential cation channel, subfamily M, member 6 (Trpm6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Trpm6 (225997)
Length:
6530
CDS:
65..6148

Additional Resources:

NCBI RefSeq record:
XM_017318153.2
NBCI Gene record:
Trpm6 (225997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144989 AGGTCATGATGTAGCGATAG pXPR_003 CGG 3284 54% 24 0.5321 Trpm6 TRPM6 77334
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362157 GATACCTTCGGCACCATTAAT pLKO_005 314 CDS 100% 15.000 21.000 N Trpm6 n/a
2 TRCN0000023947 CCGGAAATACAATAACAACAA pLKO.1 5728 CDS 100% 4.950 6.930 N Trpm6 n/a
3 TRCN0000362010 CCGCAAAGCCATGCGAGTTAT pLKO_005 5416 CDS 100% 13.200 10.560 N Trpm6 n/a
4 TRCN0000023945 GCCACAATTTAGTCAGGTGTT pLKO.1 174 CDS 100% 4.050 3.240 N Trpm6 n/a
5 TRCN0000362070 CATAACTGTTGACACCTTAAA pLKO_005 3730 CDS 100% 13.200 9.240 N Trpm6 n/a
6 TRCN0000023944 GCAGAGATAAAGCTCTCATTA pLKO.1 4680 CDS 100% 13.200 9.240 N Trpm6 n/a
7 TRCN0000023946 CCTCCCTTTATCCTGCTGAAT pLKO.1 3389 CDS 100% 4.950 3.465 N Trpm6 n/a
8 TRCN0000023948 GCCCTACAAATCCAAGGAGAA pLKO.1 1795 CDS 100% 4.050 2.835 N Trpm6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318153.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.