Transcript: Mouse XM_017318167.1

PREDICTED: Mus musculus hyaluronic acid binding protein 2 (Habp2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Habp2 (226243)
Length:
2089
CDS:
640..1635

Additional Resources:

NCBI RefSeq record:
XM_017318167.1
NBCI Gene record:
Habp2 (226243)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012183 CCGTTCTGACAAGTGTACCTT pLKO.1 1834 3UTR 100% 3.000 4.200 N Habp2 n/a
2 TRCN0000297788 CCGTTCTGACAAGTGTACCTT pLKO_005 1834 3UTR 100% 3.000 4.200 N Habp2 n/a
3 TRCN0000012184 CGTCAAGGTGAACAGTGAGAA pLKO.1 726 CDS 100% 4.950 3.960 N Habp2 n/a
4 TRCN0000280169 CGTCAAGGTGAACAGTGAGAA pLKO_005 726 CDS 100% 4.950 3.960 N Habp2 n/a
5 TRCN0000012186 GCTCCTGGATGCTAAAGTCAA pLKO.1 1341 CDS 100% 4.950 3.465 N Habp2 n/a
6 TRCN0000280226 GCTCCTGGATGCTAAAGTCAA pLKO_005 1341 CDS 100% 4.950 3.465 N Habp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.