Transcript: Mouse XM_017318254.1

PREDICTED: Mus musculus synaptotagmin VII (Syt7), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Syt7 (54525)
Length:
6854
CDS:
586..2118

Additional Resources:

NCBI RefSeq record:
XM_017318254.1
NBCI Gene record:
Syt7 (54525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240858 AGTCTTTCGCCTTCGACATAC pLKO_005 1910 CDS 100% 10.800 15.120 N Syt7 n/a
2 TRCN0000240859 GTCAGCCTTAGCGTCACTATC pLKO_005 7 5UTR 100% 10.800 15.120 N Syt7 n/a
3 TRCN0000240857 GGACACTGAGGATAGTATATA pLKO_005 2591 3UTR 100% 15.000 10.500 N Syt7 n/a
4 TRCN0000174338 CTGGAATGAGACCTTTCTATT pLKO.1 1503 CDS 100% 13.200 9.240 N Syt7 n/a
5 TRCN0000240860 GGTGAAGCGGAAGAATCTAAA pLKO_005 1476 CDS 100% 13.200 9.240 N Syt7 n/a
6 TRCN0000007970 ACTGGGCAAACGCTACAAGAA pLKO.1 63 5UTR 100% 4.950 3.465 N SYT7 n/a
7 TRCN0000349644 ACTGGGCAAACGCTACAAGAA pLKO_005 63 5UTR 100% 4.950 3.465 N SYT7 n/a
8 TRCN0000175581 CACGATCATCATCACTGTCAT pLKO.1 1953 CDS 100% 4.950 3.465 N Syt7 n/a
9 TRCN0000176047 GTTCAGTGTTGGCTACAACTT pLKO.1 1326 CDS 100% 4.950 3.465 N Syt7 n/a
10 TRCN0000173465 GCTACAACTTCCAAGAGTCCA pLKO.1 1337 CDS 100% 2.640 1.848 N Syt7 n/a
11 TRCN0000176121 GATGTATAAAGACAAGCGGGT pLKO.1 1836 CDS 100% 0.540 0.378 N Syt7 n/a
12 TRCN0000240861 TGAAGGTGTGGCTGATGTATA pLKO_005 1823 CDS 100% 13.200 7.920 N Syt7 n/a
13 TRCN0000175912 GACAAAGAAGAGGAACCTGAA pLKO.1 1875 CDS 100% 4.050 2.430 N Syt7 n/a
14 TRCN0000194143 GTGAGAAGAAAGCCATCAAGT pLKO.1 128 5UTR 100% 4.950 3.465 N Syt7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.