Transcript: Mouse XM_017318329.1

PREDICTED: Mus musculus vomeronasal 2, receptor 121 (Vmn2r121), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r121 (100038941)
Length:
1401
CDS:
1..1311

Additional Resources:

NCBI RefSeq record:
XM_017318329.1
NBCI Gene record:
Vmn2r121 (100038941)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104880 GCTGTATCATTTCTGGCTTAT pLKO.1 1365 3UTR 100% 10.800 5.400 Y Vmn2r-ps159 n/a
2 TRCN0000042752 CATACTATATTGGAGTGGAAT pLKO.1 1039 CDS 100% 4.950 2.475 Y Vmn2r-ps159 n/a
3 TRCN0000104882 CTTTGGACCATTTAATCCTAA pLKO.1 492 CDS 100% 4.950 2.475 Y Vmn2r-ps159 n/a
4 TRCN0000042741 GCACACCACAAAGTTGAGATT pLKO.1 958 CDS 100% 4.950 2.475 Y Vmn2r89 n/a
5 TRCN0000027858 GCAAACAATGAACACTGCCAA pLKO.1 999 CDS 100% 2.640 1.320 Y Vmn2r123 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318329.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.