Transcript: Mouse XM_017318378.1

PREDICTED: Mus musculus dystrophin, muscular dystrophy (Dmd), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmd (13405)
Length:
10257
CDS:
2658..9779

Additional Resources:

NCBI RefSeq record:
XM_017318378.1
NBCI Gene record:
Dmd (13405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318378.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077146 CGGAAGTAAATCTGGATAGTT pLKO.1 3673 CDS 100% 5.625 7.875 N Dmd n/a
2 TRCN0000077147 GCGGCAAATTGAGAGCAATTT pLKO.1 8531 CDS 100% 1.320 1.848 N Dmd n/a
3 TRCN0000077145 CCGACCTGTTTGATTGGAATA pLKO.1 3190 CDS 100% 10.800 8.640 N Dmd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318378.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.