Transcript: Mouse XM_017318388.1

PREDICTED: Mus musculus histone deacetylase 6 (Hdac6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hdac6 (15185)
Length:
3869
CDS:
67..3516

Additional Resources:

NCBI RefSeq record:
XM_017318388.1
NBCI Gene record:
Hdac6 (15185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321257 CCATGCTCAGCACAATCTTAT pLKO_005 708 CDS 100% 13.200 18.480 N Hdac6 n/a
2 TRCN0000380796 CCCAATCTAGCGGAGGTAAAG pLKO_005 196 CDS 100% 10.800 15.120 N HDAC6 n/a
3 TRCN0000321324 ACCCTTTGCCAGGTGCTTATT pLKO_005 3624 3UTR 100% 13.200 10.560 N Hdac6 n/a
4 TRCN0000321258 CCTTGCTGGTGGCCGTATTAT pLKO_005 2367 CDS 100% 15.000 10.500 N Hdac6 n/a
5 TRCN0000321325 TGAGGATGACCCTAGTGTATT pLKO_005 2043 CDS 100% 13.200 9.240 N Hdac6 n/a
6 TRCN0000008415 CGCTGACTACATTGCTGCTTT pLKO.1 1011 CDS 100% 4.950 3.465 N Hdac6 n/a
7 TRCN0000321323 CGCTGACTACATTGCTGCTTT pLKO_005 1011 CDS 100% 4.950 3.465 N Hdac6 n/a
8 TRCN0000008414 GAACCCATCTTGAATACCCTT pLKO.1 3609 3UTR 100% 2.640 1.848 N Hdac6 n/a
9 TRCN0000008417 GCACAATCTTATGGATGGGTA pLKO.1 717 CDS 100% 2.640 1.848 N Hdac6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.